circad | circRNAs associated with diseases

circSMARCA5
Gene	SMARCA5	Organism	Human
Genome Locus		Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	30956729
Experimental Method
Sample Type	Tissue and cell lines	Comparison	60 GC tissues and their paired adjuvant nontumor mucosa
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTCCAAGATGGGCGAAAG Reverse TGTGTTGCTCCATGTCTAATCA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Cai, J, Chen, Z, Zuo, X (2019). circSMARCA5 Functions as a Diagnostic and Prognostic Biomarker for Gastric Cancer. Dis. Markers, 2019:2473652.